|
Left Crispr |
Right Crispr |
| Crispr ID |
1086486071 |
1086486080 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:87303351-87303373
|
11:87303393-87303415
|
| Sequence |
CCAGCCACCCAGTCAGTGGAAAA |
GTCCCTGGTGCCAAAAAGGTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 17, 3: 65, 4: 369} |
{0: 923, 1: 1683, 2: 1429, 3: 952, 4: 599} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|