ID: 1086566940_1086566942

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1086566940 1086566942
Species Human (GRCh38) Human (GRCh38)
Location 11:88238088-88238110 11:88238124-88238146
Sequence CCTTAAGCAAGTAACTTGTCCTA GTTTTCTTGTGACTAAAACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 305} {0: 1, 1: 0, 2: 5, 3: 35, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!