ID: 1086581921_1086581929

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1086581921 1086581929
Species Human (GRCh38) Human (GRCh38)
Location 11:88409179-88409201 11:88409213-88409235
Sequence CCCAGTATGGCCAAATCCGTTGA ACCTTCACCATGGTGTCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 11, 4: 52} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!