ID: 1086591232_1086591239

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1086591232 1086591239
Species Human (GRCh38) Human (GRCh38)
Location 11:88516479-88516501 11:88516529-88516551
Sequence CCTGAGGGACTGTAAGATAAAAG TGGGAAAATAATTCCTGTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 193} {0: 1, 1: 0, 2: 2, 3: 38, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!