ID: 1086592236_1086592239

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1086592236 1086592239
Species Human (GRCh38) Human (GRCh38)
Location 11:88529042-88529064 11:88529080-88529102
Sequence CCCGTTTTGCAAATAAGTAGCAG GCAGTAGAGAATCTAGTGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 208} {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!