ID: 1086596091_1086596096

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1086596091 1086596096
Species Human (GRCh38) Human (GRCh38)
Location 11:88572757-88572779 11:88572793-88572815
Sequence CCATCAATGGTTGTATTTTTTAT TTACTGTAATGGTAAGTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 646} {0: 1, 1: 0, 2: 0, 3: 13, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!