ID: 1086606781_1086606785

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1086606781 1086606785
Species Human (GRCh38) Human (GRCh38)
Location 11:88705118-88705140 11:88705158-88705180
Sequence CCATATCATAAAAGAAGCAGAAT TACTCTGTCCAGTGTGGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 25, 4: 423} {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!