ID: 1086616283_1086616289

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1086616283 1086616289
Species Human (GRCh38) Human (GRCh38)
Location 11:88824455-88824477 11:88824493-88824515
Sequence CCAACTTTACTGGCACCAGGGAC CAATTTTTCCACAGGACAGTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 101, 3: 1326, 4: 1923} {0: 1, 1: 0, 2: 8, 3: 53, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!