ID: 1086647820_1086647825

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1086647820 1086647825
Species Human (GRCh38) Human (GRCh38)
Location 11:89246602-89246624 11:89246620-89246642
Sequence CCTGCCTCCCTCCTTAGCTACAG TACAGATTAATTACATCTTCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 21, 4: 334} {0: 2, 1: 1, 2: 1, 3: 18, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!