ID: 1086654285_1086654288

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1086654285 1086654288
Species Human (GRCh38) Human (GRCh38)
Location 11:89332166-89332188 11:89332183-89332205
Sequence CCCCGGAGAGCTTATTCACTCGT ACTCGTTGTATTACAGATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49} {0: 2, 1: 0, 2: 1, 3: 1, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!