ID: 1086690715_1086690718

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1086690715 1086690718
Species Human (GRCh38) Human (GRCh38)
Location 11:89786817-89786839 11:89786836-89786858
Sequence CCTGCGCTGTTTTACTAAAGAGG GAGGCTGTTCAGGCCCAGTCAGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 3, 3: 4, 4: 78} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!