ID: 1086695071_1086695079

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1086695071 1086695079
Species Human (GRCh38) Human (GRCh38)
Location 11:89834505-89834527 11:89834529-89834551
Sequence CCCTCAAATCCATCTTTCCAAGG GTTCTGGGCTGGAATTTTTAAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 19, 3: 44, 4: 272} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!