ID: 1086695071_1086695083

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1086695071 1086695083
Species Human (GRCh38) Human (GRCh38)
Location 11:89834505-89834527 11:89834542-89834564
Sequence CCCTCAAATCCATCTTTCCAAGG ATTTTTAAGGGGATTGTGGAAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 19, 3: 44, 4: 272} {0: 4, 1: 12, 2: 34, 3: 77, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!