ID: 1086695073_1086695084

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1086695073 1086695084
Species Human (GRCh38) Human (GRCh38)
Location 11:89834506-89834528 11:89834547-89834569
Sequence CCTCAAATCCATCTTTCCAAGGA TAAGGGGATTGTGGAAGGTGAGG
Strand - +
Off-target summary No data {0: 2, 1: 7, 2: 28, 3: 50, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!