ID: 1086695078_1086695083

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1086695078 1086695083
Species Human (GRCh38) Human (GRCh38)
Location 11:89834522-89834544 11:89834542-89834564
Sequence CCAAGGAGTTCTGGGCTGGAATT ATTTTTAAGGGGATTGTGGAAGG
Strand - +
Off-target summary {0: 3, 1: 9, 2: 26, 3: 168, 4: 1300} {0: 4, 1: 12, 2: 34, 3: 77, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!