ID: 1086718001_1086718008

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1086718001 1086718008
Species Human (GRCh38) Human (GRCh38)
Location 11:90086621-90086643 11:90086671-90086693
Sequence CCCCATGAATGGATACCACAAGT AGATGCAACATTTGTCAGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 0, 3: 9, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!