ID: 1086722901_1086722908

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1086722901 1086722908
Species Human (GRCh38) Human (GRCh38)
Location 11:90144187-90144209 11:90144240-90144262
Sequence CCCCCAACTTTAATGAATGAAGA ACATACCTAGAAGGTGTAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 212} {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!