ID: 1086785102_1086785106

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1086785102 1086785106
Species Human (GRCh38) Human (GRCh38)
Location 11:90958996-90959018 11:90959027-90959049
Sequence CCATTCACAATTACCATAAAAAC ACCTAGGAATACAGCTAATCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 75, 3: 641, 4: 2096} {0: 43, 1: 458, 2: 1297, 3: 1553, 4: 2929}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!