ID: 1086931150_1086931163

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1086931150 1086931163
Species Human (GRCh38) Human (GRCh38)
Location 11:92694640-92694662 11:92694684-92694706
Sequence CCATGTGACCCTGGGCAAGGAGC CCAGGGGAACAGAGGGCAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 81, 4: 528} {0: 1, 1: 0, 2: 2, 3: 45, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!