ID: 1086936140_1086936147

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1086936140 1086936147
Species Human (GRCh38) Human (GRCh38)
Location 11:92747434-92747456 11:92747459-92747481
Sequence CCCACAAAACCATTTTTTCCTCC GGCCTCCAGGAAGCCTGTGATGG
Strand - +
Off-target summary {0: 162, 1: 561, 2: 992, 3: 1534, 4: 1875} {0: 1, 1: 0, 2: 3, 3: 40, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!