|
Left Crispr |
Right Crispr |
| Crispr ID |
1087032210 |
1087032212 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:93716977-93716999
|
11:93717008-93717030
|
| Sequence |
CCATAAAACAAAGGAAAATTTGT |
TCCCTATGTTGAAGGAGTGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 26, 1: 17, 2: 18, 3: 83, 4: 931} |
{0: 2, 1: 22, 2: 39, 3: 36, 4: 117} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|