ID: 1087071174_1087071177

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1087071174 1087071177
Species Human (GRCh38) Human (GRCh38)
Location 11:94082372-94082394 11:94082400-94082422
Sequence CCTCCAAGCTGTACCTTTTATGT TTTCTTTCTTCTCTGTAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 188} {0: 1, 1: 0, 2: 13, 3: 112, 4: 1080}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!