ID: 1087071521_1087071526

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1087071521 1087071526
Species Human (GRCh38) Human (GRCh38)
Location 11:94086140-94086162 11:94086168-94086190
Sequence CCTGTTTCCCCACATGGCCACAA TTCATGCAGCCAGACCATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 389} {0: 1, 1: 0, 2: 0, 3: 13, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!