ID: 1087076193_1087076203

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1087076193 1087076203
Species Human (GRCh38) Human (GRCh38)
Location 11:94129015-94129037 11:94129036-94129058
Sequence CCGAGTGCCGCGCGCGGCCCGGG GGGACTTGCACGGGCGTGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 163} {0: 1, 1: 0, 2: 0, 3: 4, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!