ID: 1087078358_1087078368

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1087078358 1087078368
Species Human (GRCh38) Human (GRCh38)
Location 11:94146578-94146600 11:94146620-94146642
Sequence CCAGGGTGCTGTCCTGAGGACCC CCTGCCAGCAATGCAGAATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 239} {0: 1, 1: 0, 2: 2, 3: 15, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!