ID: 1087095230_1087095234

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1087095230 1087095234
Species Human (GRCh38) Human (GRCh38)
Location 11:94311754-94311776 11:94311783-94311805
Sequence CCATTGTTCATTTGTAGATTCAG AATCCCAGGGATAAAAATTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!