ID: 1087104176_1087104185

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1087104176 1087104185
Species Human (GRCh38) Human (GRCh38)
Location 11:94394066-94394088 11:94394082-94394104
Sequence CCAGGGTCCAGTGAGAGGACTGG GGACTGGGGAGGGGTCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 202} {0: 1, 1: 1, 2: 6, 3: 83, 4: 704}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!