ID: 1087112627_1087112631

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1087112627 1087112631
Species Human (GRCh38) Human (GRCh38)
Location 11:94487597-94487619 11:94487613-94487635
Sequence CCTCCAAAGTGCTGTAACAGACA ACAGACATTACAGGGACAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 218} {0: 1, 1: 0, 2: 3, 3: 35, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!