ID: 1087141253_1087141269

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1087141253 1087141269
Species Human (GRCh38) Human (GRCh38)
Location 11:94768206-94768228 11:94768254-94768276
Sequence CCCGGGGAGGGGCGGCGGGTGTC GCCGGGCGCCACGGCGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 307} {0: 1, 1: 0, 2: 2, 3: 37, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!