ID: 1087141728_1087141736

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1087141728 1087141736
Species Human (GRCh38) Human (GRCh38)
Location 11:94770598-94770620 11:94770638-94770660
Sequence CCCTCCCCCTTCTTTTTAAAATG TTCAGGTTCTTTGCAGATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 674} {0: 1, 1: 0, 2: 0, 3: 23, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!