ID: 1087162602_1087162605

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1087162602 1087162605
Species Human (GRCh38) Human (GRCh38)
Location 11:94964058-94964080 11:94964082-94964104
Sequence CCAAGGAGAAGTACCAGCTGAAG GCTCAGAGCAGAACTCTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 267} {0: 1, 1: 0, 2: 0, 3: 20, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!