ID: 1087175149_1087175158

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1087175149 1087175158
Species Human (GRCh38) Human (GRCh38)
Location 11:95089586-95089608 11:95089616-95089638
Sequence CCACTCTTGGTAGCGCGCGTCCC GCTGAGACCAGGCGGCGCGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!