ID: 1087177877_1087177878

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1087177877 1087177878
Species Human (GRCh38) Human (GRCh38)
Location 11:95111648-95111670 11:95111661-95111683
Sequence CCACAGCTGATCTCATAGGAGGC CATAGGAGGCAGAGCTTAGACGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 75, 3: 524, 4: 1063} {0: 1, 1: 1, 2: 6, 3: 111, 4: 880}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!