ID: 1087252403_1087252408

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1087252403 1087252408
Species Human (GRCh38) Human (GRCh38)
Location 11:95917766-95917788 11:95917781-95917803
Sequence CCCTCATCATGTTGCACATGCTG ACATGCTGAGGAGGAAAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 290} {0: 1, 1: 0, 2: 6, 3: 82, 4: 695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!