ID: 1087252403_1087252410

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1087252403 1087252410
Species Human (GRCh38) Human (GRCh38)
Location 11:95917766-95917788 11:95917783-95917805
Sequence CCCTCATCATGTTGCACATGCTG ATGCTGAGGAGGAAAAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 290} {0: 1, 1: 2, 2: 33, 3: 147, 4: 1074}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!