ID: 1087268497_1087268500

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1087268497 1087268500
Species Human (GRCh38) Human (GRCh38)
Location 11:96086788-96086810 11:96086818-96086840
Sequence CCTGGTAGGCATATCAGGAAACT CTGTGGATTCAGATAAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121} {0: 1, 1: 0, 2: 0, 3: 14, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!