ID: 1087283969_1087283976

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1087283969 1087283976
Species Human (GRCh38) Human (GRCh38)
Location 11:96244145-96244167 11:96244186-96244208
Sequence CCGTGTTCCAGATGTTTTGAAAT AGCCTCAGTGTCTCCCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 390} {0: 1, 1: 0, 2: 6, 3: 35, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!