ID: 1087290150_1087290154

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1087290150 1087290154
Species Human (GRCh38) Human (GRCh38)
Location 11:96312258-96312280 11:96312295-96312317
Sequence CCCTGCCTTTCTCAATCAAGTTT GAAAACTCCAAAGCCAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 347} {0: 1, 1: 0, 2: 0, 3: 31, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!