ID: 1087291580_1087291583

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1087291580 1087291583
Species Human (GRCh38) Human (GRCh38)
Location 11:96326479-96326501 11:96326499-96326521
Sequence CCTTTGCTGAAAGTCTTAAAAAC AACTATCTCGAGTTTAGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 303} {0: 1, 1: 0, 2: 0, 3: 0, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!