ID: 1087307253_1087307262

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1087307253 1087307262
Species Human (GRCh38) Human (GRCh38)
Location 11:96501663-96501685 11:96501690-96501712
Sequence CCCACTGCCATCACCGCCTTGGA AGGGTAACACTGTCAGTATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 118} {0: 1, 1: 1, 2: 0, 3: 9, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!