ID: 1087343483_1087343489

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1087343483 1087343489
Species Human (GRCh38) Human (GRCh38)
Location 11:96938453-96938475 11:96938494-96938516
Sequence CCTATAAGTGAGAGCATGGGGTG TGTTAGTTTGCTGGGGATAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!