|
Left Crispr |
Right Crispr |
| Crispr ID |
1087524841 |
1087524846 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:99296696-99296718
|
11:99296734-99296756
|
| Sequence |
CCTGTTTTTCCCAGGGAGTCCAG |
ATATCCACTTTTAATTAAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 11, 2: 15, 3: 41, 4: 213} |
{0: 4, 1: 3, 2: 7, 3: 23, 4: 172} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|