ID: 1087543849_1087543854

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1087543849 1087543854
Species Human (GRCh38) Human (GRCh38)
Location 11:99558585-99558607 11:99558628-99558650
Sequence CCTGCAAAAGAGCTATTATACAG AAAATACTCAGCCTGATATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 257} {0: 1, 1: 0, 2: 1, 3: 20, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!