ID: 1087571090_1087571092

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1087571090 1087571092
Species Human (GRCh38) Human (GRCh38)
Location 11:99928517-99928539 11:99928531-99928553
Sequence CCAGGCTCAACACCACATGGAAG ACATGGAAGATGCCAAAGTGTGG
Strand - +
Off-target summary {0: 4, 1: 15, 2: 20, 3: 36, 4: 164} {0: 1, 1: 1, 2: 19, 3: 157, 4: 1020}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!