|
Left Crispr |
Right Crispr |
| Crispr ID |
1087571090 |
1087571096 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:99928517-99928539
|
11:99928555-99928577
|
| Sequence |
CCAGGCTCAACACCACATGGAAG |
GCTTGCACCCTCCGAAGCCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 15, 2: 20, 3: 36, 4: 164} |
{0: 4, 1: 342, 2: 823, 3: 993, 4: 794} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|