ID: 1087577190_1087577196

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1087577190 1087577196
Species Human (GRCh38) Human (GRCh38)
Location 11:100004079-100004101 11:100004131-100004153
Sequence CCTGAGCATCCGCGTGGCTCCCA CAAGCACATGGTGCTCTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85} {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!