ID: 1087603325_1087603333

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1087603325 1087603333
Species Human (GRCh38) Human (GRCh38)
Location 11:100343503-100343525 11:100343555-100343577
Sequence CCAGAGTTTGGATTCTCCTCAGA GAAAGCTCCTCCTGACACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172} {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!