ID: 1087607905_1087607907

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1087607905 1087607907
Species Human (GRCh38) Human (GRCh38)
Location 11:100399427-100399449 11:100399450-100399472
Sequence CCAAGAATAGAATTAATAGTTAA TGCTAAGTCAATAAAGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 15, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!