ID: 1087660845_1087660851

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1087660845 1087660851
Species Human (GRCh38) Human (GRCh38)
Location 11:100986347-100986369 11:100986394-100986416
Sequence CCTGAGGTGGGAATGAATTTGGC CATTGTGACTGGAGTAGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 80, 4: 328} {0: 1, 1: 2, 2: 2, 3: 47, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!