|
Left Crispr |
Right Crispr |
| Crispr ID |
1087671201 |
1087671205 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
11:101109046-101109068
|
11:101109096-101109118
|
| Sequence |
CCACAAACCTTGCCCATGTAAGA |
GTTCAGACTGCTCCACCAATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 52, 3: 144, 4: 439} |
{0: 1, 1: 7, 2: 79, 3: 158, 4: 376} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|